The mRNA sequence belоw cоntаins nucleоtides thаt encode the first аmino acids of the protein made by the nuclear fallout (nuf) gene in Drosophila: 5’-GUAAAUCAUGAGUAGUCAACCUGCCAGC…-3’ wildtype nuf mRNA What are the first five amino acids encoded by this mRNA (use three letter abreviations given in the codon table below)? You isolate a nuf gene mutant and determine the base sequence of the mutant mRNA: 5’- GUAAAUCAUGAGUAGUAAACCUGCCAGC…-3’ mutant nuf mRNA What are the first five amino acids encoded by this mRNA (use codon table below)? Is the mutation in the gene a transition, transversion, insertion, or deletion? In the wildtype sequence below, identify a single base pair change that would lead to an early stop (nonsense mutation). Which nucleotide would you change (A-E)? What nucleotide would you change it to (A, T, G or C)?